ATCG DNA Code Applies Across All Living Things

Knowing this order is the first step in our efforts to map the DNA sequences of all organisms and thereby connect gene sequence with gene function.

ACGT is an acronym for the four types of bases found in a DNA molecule: adenine (A), cytosine (C), guanine (G), and thymine (T).

The four types of nitrogen bases found in nucleotides are: adenine (A), thymine (T), guanine (G) and cytosine (C). The order, or sequence, of these bases determines what biological instructions are contained in a strand of DNA. For example, the sequence ATCGTT might instruct for blue eyes, while ATCGCT might instruct for brown.

Checking your browser before accessing pmc.ncbi.nlm.nih.gov · Click here if you are not automatically redirected after 5 seconds

Of the 16 nucleotide bases that could pair up to make DNA, why do only A, T, G, and C make up the genomic alphabet? Researchers have long put it down to the composition of the primordial soup in which the first life arose.

They are adenine (A), cytosine (C), guanine (G), and thymine (T). Nucleotides are strung together into long sequences known as chromosomes, and each chromosome has thousands of genes. Together, these are the instructions for making an organism. You can think of these DNA sequence instructions as chemical sentences. The sequence ATCGGGTCA might say “make curly red hair,” and TTCGGGATCACACCACATGACCCG might say “make brown eyes.”

Genomic DNA is composed of four standard nucleotides, each with a different nucleobase: adenine (A), thymine (T), cytosine (C), and guanine (G). These nucleobases form the genetic alphabet, ATCG, which is conserved across all domains of life.

A study finds that one microbe, a member of the Archaea, tolerates a little flexibility in interpreting the genetic code, contradicting a 60-year-old doctrine. The beauty of the DNA code is that organisms interpret it unambiguously.

The first living organism to carry and pass down to future generations an expanded genetic code has been created by American scientists, paving the way for a host of new life forms whose cells carry synthetic DNA that looks nothing like the ...